Share this post on:

Lls (PBMCs) were obtained from normal individual donors from the Blood Bank Service of the University of Perugia Hospital. PBMCsFXR Is a Novel TLR-9 Target GeneFigure 7. IRF7 binds to the an IRF7-RE located in the FXR promoter. (A) Electrophoretic Mobility shift assay (EMSA). Nuclear extracts from Raw264.7 cells left untreated or stimulated with CpG were incubated in the presence of a wild type or a mutated IRF7 Daporinad web biotin-labeled probe. Competition experiments were performed with a 100 fold excess of unlabeled oligo or with 1 mg IRF7 antibody. (B) Chromatin immunoprecipitation (ChIP). ChIP assay carried out in Raw264.7 cells left untreated or primed with CpG as described in materials and methods section. Values are normalized relative to input DNA concentration and are expressed relative to those of not treated cells immunoprecipitated with an anti IgG antibody, condition set as 1. Analysis was carried out in triplicate and the experiment was repeated twice. *P,0.05 versus not treated cells immunoprecipitated with an anti-IgG antibody. #P,0.05 versus not treated cells immunoprecipitated with an anti-IRF7 antibody. doi:10.1371/journal.pone.0054472.gwere isolated by density gradient centrifugation through a FicollHypaque gradien (Pharmacia Biotech). Monocytes were isolated by positive selection using magnetic cell sorting according to the manufacturer’s instructions (Miltenyi Biotec). After isolation monocytes were cultured in R-PMI and stimulated 18 18325633 hours with the following TLR ligands: (i) TLR1/2: 100 ng/ml Pam3Cys-Ser(Lys)4.3HCl; (ii) TLR3: 100 mg/ml Polyinosinic-polycytidylic acid potassium salt (Poly IC); (iii) TLR4: 1 mg/ml Lipopolysaccharide from E. coli, Serotype R515; (iv) TLR5: 100 ng/ml Flagellin (FLIC); (v) TLR6: 100 ng/ml Macrophage stimulatory Lipopeptide 2 (MALP-2); (vi) TLR7?: 10 mg/ml Polyuridylic acid potassium salt and (vii) TLR9: 2 mg/ml CpG ODN 2395. Mouse monocytes were obtained from the spleens of TLR9 wild-type and null mice (C57BL/6BJ6 background) following a previous described protocol [19]. After isolation primary murine monocytes were cultured in RPM-I and stimulated 18 hours with 2 mg/ml CpG ODN 2395.BIOTECH. Human (h) and murine (m) sense and antisense primers were as following: hFXR: tacatgcgaagaaagtgtcaaga and MedChemExpress A1443 actgtcttcattcacggtctgat; hTNFa: aacctcctctctgccatcaa and ggaagacccctcccagatag; hGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa; mFXR:; mTNFa: acggcatggatctcaaagac and gtgggtgaggagcacgtagt; mIRF7: agccctctgctttctagtgatg and ctgcatagggttcctcgtaaac; mGAPDH: ctgagtatgtcgtggagtctac and gttggtggtgcaggatgcattg.FXR promoter analysis, plasmid construction and Luciferase assayHuman and murine proximal promoter regions of FXR were analyzed with the on-line software TFsearch ( research/db/TFSEARCH.html) for the search of putative IRF7 consensus sequences (GAA (A/T) N (C/T) GAAAN (T/C)). For luciferase assay, three tandem repeats of the putative IRF7 responsive sequence (IRF7RE) were cloned KpnI-XhoI into the pGL4 luciferase reporter vector (pGL3(IRF7RE)3X) using the following oligonucleotides: ACTGGGTACCCCTGAATATCAAAGCTGCCCTGAATATCAAAGCTGCCCTGAATATCAAAGCTGCCTCGAGACTG and CAGTCTCGAGGCAGCTTTGATATTCAGGGCAGCTTTGATATTCAGGGCAGCTTTGATATTCAGGGGTACCCAGT. 24 h before transfection, 106105 Raw264.7 cells were plated in six-well plates and cultured in D-MEM. Subsequently, cells were transiently transfected using 1 mg pGL4(IRF7RE)3X and 200 ng pCMVbgalactosidase as an internal control for transfection eff.Lls (PBMCs) were obtained from normal individual donors from the Blood Bank Service of the University of Perugia Hospital. PBMCsFXR Is a Novel TLR-9 Target GeneFigure 7. IRF7 binds to the an IRF7-RE located in the FXR promoter. (A) Electrophoretic Mobility shift assay (EMSA). Nuclear extracts from Raw264.7 cells left untreated or stimulated with CpG were incubated in the presence of a wild type or a mutated IRF7 biotin-labeled probe. Competition experiments were performed with a 100 fold excess of unlabeled oligo or with 1 mg IRF7 antibody. (B) Chromatin immunoprecipitation (ChIP). ChIP assay carried out in Raw264.7 cells left untreated or primed with CpG as described in materials and methods section. Values are normalized relative to input DNA concentration and are expressed relative to those of not treated cells immunoprecipitated with an anti IgG antibody, condition set as 1. Analysis was carried out in triplicate and the experiment was repeated twice. *P,0.05 versus not treated cells immunoprecipitated with an anti-IgG antibody. #P,0.05 versus not treated cells immunoprecipitated with an anti-IRF7 antibody. doi:10.1371/journal.pone.0054472.gwere isolated by density gradient centrifugation through a FicollHypaque gradien (Pharmacia Biotech). Monocytes were isolated by positive selection using magnetic cell sorting according to the manufacturer’s instructions (Miltenyi Biotec). After isolation monocytes were cultured in R-PMI and stimulated 18 18325633 hours with the following TLR ligands: (i) TLR1/2: 100 ng/ml Pam3Cys-Ser(Lys)4.3HCl; (ii) TLR3: 100 mg/ml Polyinosinic-polycytidylic acid potassium salt (Poly IC); (iii) TLR4: 1 mg/ml Lipopolysaccharide from E. coli, Serotype R515; (iv) TLR5: 100 ng/ml Flagellin (FLIC); (v) TLR6: 100 ng/ml Macrophage stimulatory Lipopeptide 2 (MALP-2); (vi) TLR7?: 10 mg/ml Polyuridylic acid potassium salt and (vii) TLR9: 2 mg/ml CpG ODN 2395. Mouse monocytes were obtained from the spleens of TLR9 wild-type and null mice (C57BL/6BJ6 background) following a previous described protocol [19]. After isolation primary murine monocytes were cultured in RPM-I and stimulated 18 hours with 2 mg/ml CpG ODN 2395.BIOTECH. Human (h) and murine (m) sense and antisense primers were as following: hFXR: tacatgcgaagaaagtgtcaaga and actgtcttcattcacggtctgat; hTNFa: aacctcctctctgccatcaa and ggaagacccctcccagatag; hGAPDH: gaaggtgaaggtcggagt and catgggtggaatcatattggaa; mFXR:; mTNFa: acggcatggatctcaaagac and gtgggtgaggagcacgtagt; mIRF7: agccctctgctttctagtgatg and ctgcatagggttcctcgtaaac; mGAPDH: ctgagtatgtcgtggagtctac and gttggtggtgcaggatgcattg.FXR promoter analysis, plasmid construction and Luciferase assayHuman and murine proximal promoter regions of FXR were analyzed with the on-line software TFsearch ( research/db/TFSEARCH.html) for the search of putative IRF7 consensus sequences (GAA (A/T) N (C/T) GAAAN (T/C)). For luciferase assay, three tandem repeats of the putative IRF7 responsive sequence (IRF7RE) were cloned KpnI-XhoI into the pGL4 luciferase reporter vector (pGL3(IRF7RE)3X) using the following oligonucleotides: ACTGGGTACCCCTGAATATCAAAGCTGCCCTGAATATCAAAGCTGCCCTGAATATCAAAGCTGCCTCGAGACTG and CAGTCTCGAGGCAGCTTTGATATTCAGGGCAGCTTTGATATTCAGGGCAGCTTTGATATTCAGGGGTACCCAGT. 24 h before transfection, 106105 Raw264.7 cells were plated in six-well plates and cultured in D-MEM. Subsequently, cells were transiently transfected using 1 mg pGL4(IRF7RE)3X and 200 ng pCMVbgalactosidase as an internal control for transfection eff.

Share this post on:

Author: haoyuan2014