Ured by gamma counting from 16 weeks. The fold changes were 2.19, 2.72, and

Ured by gamma counting from 16 weeks. The fold changes were 2.19, 2.72, and 3.65 (p,0.001) for 16, 24, and 32 weeks, respectively, compared to the 0 weeks group. The comparison of 18F-FDG uptake measured by gamma counting of mice on high-fat Western diet to the mice of the same age on chow also showed a significant increase from 16 weeks. The 18 F-FDG uptake was 2.47 fold higher at 16 weeks, 2.83 fold at 24 weeks, and at 32 weeks the increase was 3.06 fold (p,0.001).Correlation of PET and Gamma CountingA correlation plot of PET and gamma counter data is shown in Figure 4. A strong correlation between 22948146 the two methods was seen with a R-value of 0.88 (p,0.001).FDG and Gene Expression in Murine AtherosclerosisFigure 2. Selection of ROIs. A Fused PET/CT image, axial view. B Fused PET/CT image with ROI drawn, axial view. C Fused PET/CT image with the ROIs after ROI interpolation, sagittal view. Most, but not the entire aorta is visible. doi:10.1371/journal.pone.0050908.gTable 2. Primers and probes.NameGene IDForward primerReverse primerAmplicon lengthProbeGenes of interestCD68 CXCL-1 HIF-1a HIF-2 a LOX-1 MCP-1 OPN TF VCAM-1 VEGF NM_09853 NM_008176 NM_010431 NM_10137 NM_138648 NM_011333 NM_009263 NM_010171 NM_011693 NM_001025250 GTGTGTCTGATCTTGCTA GCCTCTAACCAGTTCC TGCAGTATGAATGGAGTAA GGAACTTGAAGGGTTATTG GCTTCTTCCACTTGGTAC CCGTAAATCTGAAGCTAATG CTGTGTCCTCTGAAGAA CACGGGAAAGAAAACAAA GACAGGAGACATGGTATTAAAG GTGTGTGTATGAAATCTGTG GTAGGTGTCATCGTGAAG AGCTCATTGGCGATAG CTGCTAATGGGAACAGATTA CTCAGAGTGTCTTTAGTAGA GCATCAACAAATACACAGATAA AGTCCGAGTCACACTA CTCTGCATGGTCTCC CTGGAGAAAATCATAGCTTG GCCAACTTCAGTCTTAGA GAGCTGAGTGTTAGCAAA 104 145 101 107 144 101 122 102 106 100 ACCGCTTATAGCCCAAGGAACA ACTCCAGACTCCAGCCACAC CAGGAGCCTGAGCCCTCAAA CTTAACGCTGAGGCAACAACACA TGTTCATACATCTCCACCACAGTGTT TCCACAACCACCTCAAGCACT TCGTCATCATCATCGTCATCATCGT CTTACTCCTTCTTCCACATCAATCG CTCGTACACCATCCGCCAGG ATCTTCTCAGGACAAGCTAGTGACReference genesACTB B2M GUSB NM_007393 NM_009735 NM_010368 GTTGGTTGGAGCAAACATC TACGCCTGCAGAGTTAAG CTTGGTATCATGACTATGGG CATGGATACTTGGAATGACTA CTGGATTTGTAATTAAGCAGG ACTCGCTCTGGATAATCG 119 124 105 ITI 007 CCCAAAGTTCTACAAATGTGGCTGA CGAGCCCAAGACCGTCTACT ACTCGCTCTGGATAATCGdoi:10.1371/journal.pone.0050908.tFDG and Gene Expression in Murine AtherosclerosisFigure 4. Correlation plot of PET and gamma counter data. Correlation plot of SUV values from PET and gamma counter. The 95 confidence interval is indicated by the broken lines. doi:10.1371/journal.pone.0050908.gTable 3. Univariate linear regression analyses of gene expression relative to 18F-FDG SUVmean.Rp-valueMonocyte/macrophage recruitmentCXCL-1 MCP-1 VCAM-1 0.30 0.46 0.61 0.03 ,0.001 ,0.Macrophages/JSI124 price inflammationCD68 OPN 0.70 0.60 ,0.001 ,0.Figure 3. 18F-FDG uptake assessed by SUV. 18F-FDG uptake assessed by SUV expressed as mean6SEM of N = 7?2. *p,0.05, **p,0.01, and ***p,0.001 are groups vs. 0 weeks group. ##p,0.01 and ###p,0.001 are high-fat diet groups vs. normal chow groups at the same age. All p-values were Bonferroni corrected. A 18F-FDG uptake measured by PET. B 18F-FDG uptake measured by gamma counting. doi:10.1371/journal.pone.0050908.gScavenger receptorsLOX-1 0.53 ,0.HypoxiaHIF-1a HIF-2 a VEGF 20.46 20.59 20.53 ,0.001 ,0.001 ,0.Univariate Linear Regression Analysis of Gene Expression of the Molecular Markers Relative to 18F-FDG SUVmeanIn Table 3 the R-values and their p-values are listed for all gene expression markers. The gene expression of all markers of monocyte/macrophage recruitment exhibited significant correl.Ured by gamma counting from 16 weeks. The fold changes were 2.19, 2.72, and 3.65 (p,0.001) for 16, 24, and 32 weeks, respectively, compared to the 0 weeks group. The comparison of 18F-FDG uptake measured by gamma counting of mice on high-fat Western diet to the mice of the same age on chow also showed a significant increase from 16 weeks. The 18 F-FDG uptake was 2.47 fold higher at 16 weeks, 2.83 fold at 24 weeks, and at 32 weeks the increase was 3.06 fold (p,0.001).Correlation of PET and Gamma CountingA correlation plot of PET and gamma counter data is shown in Figure 4. A strong correlation between 22948146 the two methods was seen with a R-value of 0.88 (p,0.001).FDG and Gene Expression in Murine AtherosclerosisFigure 2. Selection of ROIs. A Fused PET/CT image, axial view. B Fused PET/CT image with ROI drawn, axial view. C Fused PET/CT image with the ROIs after ROI interpolation, sagittal view. Most, but not the entire aorta is visible. doi:10.1371/journal.pone.0050908.gTable 2. Primers and probes.NameGene IDForward primerReverse primerAmplicon lengthProbeGenes of interestCD68 CXCL-1 HIF-1a HIF-2 a LOX-1 MCP-1 OPN TF VCAM-1 VEGF NM_09853 NM_008176 NM_010431 NM_10137 NM_138648 NM_011333 NM_009263 NM_010171 NM_011693 NM_001025250 GTGTGTCTGATCTTGCTA GCCTCTAACCAGTTCC TGCAGTATGAATGGAGTAA GGAACTTGAAGGGTTATTG GCTTCTTCCACTTGGTAC CCGTAAATCTGAAGCTAATG CTGTGTCCTCTGAAGAA CACGGGAAAGAAAACAAA GACAGGAGACATGGTATTAAAG GTGTGTGTATGAAATCTGTG GTAGGTGTCATCGTGAAG AGCTCATTGGCGATAG CTGCTAATGGGAACAGATTA CTCAGAGTGTCTTTAGTAGA GCATCAACAAATACACAGATAA AGTCCGAGTCACACTA CTCTGCATGGTCTCC CTGGAGAAAATCATAGCTTG GCCAACTTCAGTCTTAGA GAGCTGAGTGTTAGCAAA 104 145 101 107 144 101 122 102 106 100 ACCGCTTATAGCCCAAGGAACA ACTCCAGACTCCAGCCACAC CAGGAGCCTGAGCCCTCAAA CTTAACGCTGAGGCAACAACACA TGTTCATACATCTCCACCACAGTGTT TCCACAACCACCTCAAGCACT TCGTCATCATCATCGTCATCATCGT CTTACTCCTTCTTCCACATCAATCG CTCGTACACCATCCGCCAGG ATCTTCTCAGGACAAGCTAGTGACReference genesACTB B2M GUSB NM_007393 NM_009735 NM_010368 GTTGGTTGGAGCAAACATC TACGCCTGCAGAGTTAAG CTTGGTATCATGACTATGGG CATGGATACTTGGAATGACTA CTGGATTTGTAATTAAGCAGG ACTCGCTCTGGATAATCG 119 124 105 CCCAAAGTTCTACAAATGTGGCTGA CGAGCCCAAGACCGTCTACT ACTCGCTCTGGATAATCGdoi:10.1371/journal.pone.0050908.tFDG and Gene Expression in Murine AtherosclerosisFigure 4. Correlation plot of PET and gamma counter data. Correlation plot of SUV values from PET and gamma counter. The 95 confidence interval is indicated by the broken lines. doi:10.1371/journal.pone.0050908.gTable 3. Univariate linear regression analyses of gene expression relative to 18F-FDG SUVmean.Rp-valueMonocyte/macrophage recruitmentCXCL-1 MCP-1 VCAM-1 0.30 0.46 0.61 0.03 ,0.001 ,0.Macrophages/inflammationCD68 OPN 0.70 0.60 ,0.001 ,0.Figure 3. 18F-FDG uptake assessed by SUV. 18F-FDG uptake assessed by SUV expressed as mean6SEM of N = 7?2. *p,0.05, **p,0.01, and ***p,0.001 are groups vs. 0 weeks group. ##p,0.01 and ###p,0.001 are high-fat diet groups vs. normal chow groups at the same age. All p-values were Bonferroni corrected. A 18F-FDG uptake measured by PET. B 18F-FDG uptake measured by gamma counting. doi:10.1371/journal.pone.0050908.gScavenger receptorsLOX-1 0.53 ,0.HypoxiaHIF-1a HIF-2 a VEGF 20.46 20.59 20.53 ,0.001 ,0.001 ,0.Univariate Linear Regression Analysis of Gene Expression of the Molecular Markers Relative to 18F-FDG SUVmeanIn Table 3 the R-values and their p-values are listed for all gene expression markers. The gene expression of all markers of monocyte/macrophage recruitment exhibited significant correl.